Skip to main content

Table 4 Primers used for the quantification of microRNAs in human plasmaa

From: MicroRNAs in bovine milk exosomes are bioavailable in humans but do not elicit a robust pro-inflammatory cytokine response

AmpliconForward Primer
miSPIKECTCAGGATGGCGGAGCGGTCT
miR-1-3pTGGAATGTAAAGAAGTATGTAT
miR-15b-5pTAGCACATCATGGTTTACA
miR-34a-5pTGGCAGTGTCTTAGCTGGTTGT
miR-106b-5pTAAAGTGCTGACAGTGCAGAT
miR-155-5pTTAATGCTAATCGTGATAGGGGT
miR-21-5pGCTAGCTTATCAGACTGATGTTGA
miR-223-3pCTGTCAGTTTGTCAAATACCCCA
  1. aThe reverse primer is provided in the miScript SYBR Green kit (Qiagen) and its nucleotide sequence is proprietary information