Skip to main content

Table 1 Annotation of the predicted vmiRNA sequences

From: Prediction and experimental confirmation of banana bract mosaic virus encoding miRNAs and their targets

miRNA ID and SequenceaOrientationPositionsbLocus
BBrMV miRNA 1Forward1807 to 1888HcPro
SequenceGGUAUCAGUCGUAUGAGUUACGAGUAUCUCCAAAUUGUACUAGGAAACUAGCAAUUGGAAGAUUGUUGGUCUCAACGAAUAU
BBrMV miRNA 2Forward3672 to 37636 K1-CI
SequenceGUGGGGUUUCAGAAUUUAGAUGAGAUACAAGAUAUUGAAGCAGAGAAGAAGACAACAAUUGAUUUCAUCUUAGCUGAUGAUACACCACTCGC
BBrMV miRNA 3Forward204 to 285P1 protein
SequenceUCGCCAACGAGUGUUAAGAUGACAGUCGCACCACAAUGCAUGGCGGCACUAGAGGUGGAAUGUGAUACAACACUUAAGGCGG
BBrMV miRNA 4Forward4192 to 4264CI
SequenceUCAUAAUCCUUGAUGAAUGUCAUGUUAUGGAUGCUUCAGCAAUGGCGUUCUAUUGUCUACUCAAGGAGUAUGC
BBrMV miRNA 5Forward6710 to 6808NIa
SequenceAGGUGGGUGUUUUUGGAAGCAUUGGAUUGAUACGAAGAAAGGUGAUUGUGGUUUACCUAUGGUUUCAACAAAAGAUGGCUUCAUUUUAGGCAUCCAUAG
BBrMV miRNA 6Reverse294–194P1
SequenceCUGGCGUCGCCGCCUUAAGUGUUGUAUCACAUUCCACCUCUAGUGCCGCCAUGCAUUGUGGUGCGACUGUCAUCUUAACACUCGUUGGCGAUGCUGGCUCU
BBrMV miRNA 7Reverse5225 to 5318CI
SequenceAAGUGUGCGGGGAAUUGCAAACGAAUCGCAACUGAGAGUGUAUGCAAUUGAGCAUGCACUCGCUGUUGUGAGUCGUCCAAACCCAGCAUCAGUU
  1. aThe mature miRNA sequence is mentioned in bold letters
  2. *Position of pri miRNA in the virus genome